Stem-loop sequence pte-mir-35o-1

AccessionMI0038057 (change log)
DescriptionParasteatoda tepidariorum miR-35o-1 stem-loop
Stem-loop
   --   -       ag        u  aga 
5'   agu uguuaau  cucgguga gg   a
     ||| |||||||  |||||||| ||    
3'   ucg auaauug  gggccacu cc   u
   uu   u       ga        u  cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_73: 4659837-4659893 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-35o-1
pte-mir-35o-1Scf5bK3_73: 4659837-4659893 [+]
pte-mir-35lScf5bK3_73: 4662657-4662713 [+]
pte-mir-35wScf5bK3_73: 4665401-4665457 [+]
Database links

Mature sequence pte-miR-35o-5p

Accession MIMAT0046164
Sequence

1 - 

aguuguuaauagcucggugau

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-35o-3p

Accession MIMAT0046165
Sequence

35 - 

ucaccgggagguuaauaugcuuu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).