Stem-loop sequence pte-mir-35j-2

AccessionMI0038065 (change log)
DescriptionParasteatoda tepidariorum miR-35j-2 stem-loop
Stem-loop
   --u             u    aau    a 
5'    cgagucuuucgcu cggu   uuau a
      ||||||||||||| ||||   |||| u
3'    gcuuagaaagugg gcca   aaua g
   uuc             -    -cu    a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_786: 6359442-6359498 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-35j-2
pte-mir-35kScf5bK3_786: 6359629-6359684 [-]
pte-mir-35j-2Scf5bK3_786: 6359442-6359498 [-]
pte-mir-35e-1Scf5bK3_786: 6359147-6359203 [-]
pte-mir-35r-3Scf5bK3_786: 6356599-6356660 [-]
Database links

Mature sequence pte-miR-35j-5p

Accession MIMAT0046176
Sequence

1 - 

ucgagucuuucgcuucgguaauu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-35j-3p

Accession MIMAT0046177
Sequence

36 - 

ucaccgggugaaagauucgcuu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).