Stem-loop sequence pte-mir-35e-1

AccessionMI0038066 (change log)
DescriptionParasteatoda tepidariorum miR-35e-1 stem-loop
Stem-loop
   --u       g     u    a   ucaa 
5'    cgaaucu ucacu cggu auu    u
      ||||||| ||||| |||| |||     
3'    guuuaga agugg gcca uaa    u
   uuc       a     -    c   uaac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_786: 6359147-6359203 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-35e-1
pte-mir-35kScf5bK3_786: 6359629-6359684 [-]
pte-mir-35j-2Scf5bK3_786: 6359442-6359498 [-]
pte-mir-35e-1Scf5bK3_786: 6359147-6359203 [-]
pte-mir-35r-3Scf5bK3_786: 6356599-6356660 [-]
Database links

Mature sequence pte-miR-35e-5p

Accession MIMAT0046178
Sequence

1 - 

ucgaaucugucacuucgguaauu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-35e-3p

Accession MIMAT0046179
Sequence

36 - 

ucaccgggugaaagauuugcuu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).