Stem-loop sequence pte-mir-35g

AccessionMI0038068 (change log)
DescriptionParasteatoda tepidariorum miR-35g stem-loop
Stem-loop
   --ug            g         guau 
5'     aaauuuuucgcu cggugguuu    a
       |||||||||||| |||||||||     
3'     uuugaaaagugg gccacuaaa    u
   uucg            -         aguu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_786: 6402613-6402671 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-35g
pte-mir-35zScf5bK3_786: 6406386-6406445 [-]
pte-mir-35iScf5bK3_786: 6405550-6405606 [-]
pte-mir-35fScf5bK3_786: 6405166-6405222 [-]
pte-mir-11950Scf5bK3_786: 6403352-6403408 [-]
pte-mir-35cScf5bK3_786: 6403218-6403274 [-]
pte-mir-35hScf5bK3_786: 6403027-6403083 [-]
pte-mir-35gScf5bK3_786: 6402613-6402671 [-]
pte-mir-35dScf5bK3_786: 6402310-6402366 [-]
pte-mir-35aScf5bK3_786: 6401680-6401736 [-]
pte-mir-35bScf5bK3_786: 6400546-6400602 [-]
Database links

Mature sequence pte-miR-35g-5p

Accession MIMAT0046182
Sequence

1 - 

ugaaauuuuucgcugcggugguu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-35g-3p

Accession MIMAT0046183
Sequence

38 - 

ucaccgggugaaaaguuugcuu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).