Stem-loop sequence pte-mir-35s

AccessionMI0038071 (change log)
DescriptionParasteatoda tepidariorum miR-35s stem-loop
Stem-loop
   --  u        --       u    uucu 
5'   gg ugaauguu  ccuggug ugca    u
     || ||||||||  ||||||| ||||    u
3'   cc acuuacaa  gggccac acgu    a
   cc  u        au       u    ucaa 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_238.1: 746981-747041 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-35s
pte-mir-279Scf5bK3_238.1: 780258-780318 [-]
pte-mir-279Scf5bK3_238.1: 754887-754947 [-]
pte-mir-35sScf5bK3_238.1: 746981-747041 [-]
Database links

Mature sequence pte-miR-35s-5p

Accession MIMAT0046188
Sequence

1 - 

gguugaauguuccugguguug

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-35s-3p

Accession MIMAT0046189
Sequence

39 - 

ucaccggguaaacauucaucccc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).