Stem-loop sequence pte-mir-35u

AccessionMI0038074 (change log)
DescriptionParasteatoda tepidariorum miR-35u stem-loop
Stem-loop
   --     -uu       c    g   u u 
5'   agcaa   aauggcu ggug cag g c
     |||||   ||||||| |||| ||| | u
3'   ucguu   uugcuga ccac guc c c
   uu     uau       a    a   - g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_73: 4583750-4583806 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-35u
pte-mir-35xScf5bK3_73: 4589896-4589952 [-]
pte-mir-35o-2Scf5bK3_73: 4588710-4588766 [-]
pte-mir-35yScf5bK3_73: 4588113-4588169 [-]
pte-mir-35vScf5bK3_73: 4584309-4584365 [-]
pte-mir-35uScf5bK3_73: 4583750-4583806 [-]
pte-mir-35mScf5bK3_73: 4580855-4580911 [-]
pte-mir-35tScf5bK3_73: 4579946-4580001 [-]
Database links

Mature sequence pte-miR-35u-5p

Accession MIMAT0046194
Sequence

1 - 

agcaauuaauggcucgguggc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-35u-3p

Accession MIMAT0046195
Sequence

35 - 

acaccaagucguuuauuugcuuu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).