Stem-loop sequence pte-mir-35w

AccessionMI0038077 (change log)
DescriptionParasteatoda tepidariorum miR-35w stem-loop
Stem-loop
   --     -      gc      g   u u 
5'   agcaa ugaaug  uuggug cag g c
     ||||| ||||||  |||||| ||| | u
3'   ucguu auuugc  gaccac guc c c
   uu     u      uu      a   - g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_73: 4665401-4665457 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-35w
pte-mir-35o-1Scf5bK3_73: 4659837-4659893 [+]
pte-mir-35lScf5bK3_73: 4662657-4662713 [+]
pte-mir-35wScf5bK3_73: 4665401-4665457 [+]
Database links

Mature sequence pte-miR-35w-5p

Accession MIMAT0046198
Sequence

1 - 

agcaaugaauggcuugguggc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-35w-3p

Accession MIMAT0046199
Sequence

35 - 

acaccaguucguuuauuugcuuu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).