Stem-loop sequence pte-mir-35l

AccessionMI0038078 (change log)
DescriptionParasteatoda tepidariorum miR-35l stem-loop
Stem-loop
   --     -uu            g   u    
5'   agcaa   aauggcucggug cag gcc 
     |||||   |||||||||||| ||| || u
3'   ucguu   uugcugggccac guc cgc 
   uu     uau            a   -    
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_73: 4662657-4662713 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-35l
pte-mir-35o-1Scf5bK3_73: 4659837-4659893 [+]
pte-mir-35lScf5bK3_73: 4662657-4662713 [+]
pte-mir-35wScf5bK3_73: 4665401-4665457 [+]
Database links

Mature sequence pte-miR-35l-5p

Accession MIMAT0046200
Sequence

1 - 

agcaauuaauggcucgguggc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-35l-3p

Accession MIMAT0046201
Sequence

35 - 

acaccgggucguuuauuugcuuu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).