Stem-loop sequence pte-mir-3931

AccessionMI0038090 (change log)
DescriptionParasteatoda tepidariorum miR-3931 stem-loop
Literature search

1 open access papers mention pte-mir-3931
(2 sentences)

Stem-loop
   --                u a   c   au 
5'   auuuguaccgauucaa g uag uuu  a
     |||||||||||||||| | ||| |||   
3'   uaagcauggcugaguu c auc aag  a
   ac                u -   a   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_112: 4859479-4859537 [+]
intergenic
Database links

Mature sequence pte-miR-3931-5p

Accession MIMAT0046215
Sequence

1 - 

auuuguaccgauucaaugauagcu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-3931-3p

Accession MIMAT0046216
Sequence

38 - 

uacuuugagucgguacgaauca

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).