Stem-loop sequence pte-mir-71-1

AccessionMI0038092 (change log)
DescriptionParasteatoda tepidariorum miR-71-1 stem-loop
Literature search

2 open access papers mention pte-mir-71-1
(14 sentences)

Stem-loop
   --ug       u             ucuu 
5'     aaagaca ggguagugagaug    a
       ||||||| |||||||||||||    a
3'     uuucugu uccaucacucuac    u
   gcag       -             cccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_5995: 356520-356577 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-71-1
pte-mir-71-1Scf5bK3_5995: 356520-356577 [+]
pte-mir-2eScf5bK3_5995: 356661-356719 [+]
pte-mir-2cScf5bK3_5995: 356792-356849 [+]
pte-mir-2b-2Scf5bK3_5995: 359128-359188 [+]
pte-mir-2g-2Scf5bK3_5995: 359230-359289 [+]
pte-mir-2g-1Scf5bK3_5995: 359336-359391 [+]
pte-mir-2dScf5bK3_5995: 359448-359508 [+]
Database links

Mature sequence pte-miR-71-5p

Accession MIMAT0046219
Sequence

1 - 

ugaaagacauggguagugagaug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-71-3p

Accession MIMAT0046220
Sequence

37 - 

ucucacuaccuugucuuugacg

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).