Stem-loop sequence pte-mir-8

AccessionMI0038095 (change log)
DescriptionParasteatoda tepidariorum miR-8 stem-loop
Stem-loop
   --      -   a             uc   u g 
5'   caucuu acc ggcaguauuagag  aau u a
     |||||| ||| |||||||||||||  ||| |  
3'   guagaa ugg cugucauaaucuu  uug a a
   cu      a   a             -c   u a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_12704: 8666-8731 [+]
intergenic
Scf5bK3_135: 249819-249884 [+]
intergenic
Database links

Mature sequence pte-miR-8-5p

Accession MIMAT0046223
Sequence

1 - 

caucuuaccaggcaguauuaga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-8-3p

Accession MIMAT0046224
Sequence

44 - 

uaauacugucagguaaagauguc

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).