Stem-loop sequence pte-mir-87a

AccessionMI0038096 (change log)
DescriptionParasteatoda tepidariorum miR-87a stem-loop
Stem-loop
   --c         a    u    a   cguca 
5'    caccugaaa uuug cuca ccu     u
      ||||||||| |||| |||| |||     u
3'    guggacuuu aaac gagu gga     c
   ucc         g    -    -   uaaaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_2865: 1396953-1397013 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-87a
pte-mir-87bScf5bK3_2865: 1396007-1396068 [+]
pte-mir-87aScf5bK3_2865: 1396953-1397013 [+]
Database links

Mature sequence pte-miR-87a-5p

Accession MIMAT0046225
Sequence

1 - 

ccaccugaaaauuugucucaaccu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-87a-3p

Accession MIMAT0046226
Sequence

40 - 

gugagcaaaguuucaggugccu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).