Stem-loop sequence pte-mir-9

AccessionMI0038099 (change log)
DescriptionParasteatoda tepidariorum miR-9 stem-loop
Stem-loop
   --u       u        g     -      
5'    cuuuggu aucuagcu uauga gugag 
      ||||||| |||||||| ||||| |||| u
3'    gaaacca uggaucga auacu cauuu 
   auu       u        a     g      
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_1520: 2028464-2028523 [+]
intergenic
Scf5bK3_1520: 2062759-2062818 [+]
intergenic
Database links

Mature sequence pte-miR-9-5p

Accession MIMAT0046231
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-9-3p

Accession MIMAT0046232
Sequence

39 - 

uaaagcuagguuaccaaaguua

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).