Stem-loop sequence pte-mir-92a

AccessionMI0038100 (change log)
DescriptionParasteatoda tepidariorum miR-92a stem-loop
Literature search

1 open access papers mention pte-mir-92a
(1 sentences)

Stem-loop
   --        gu  uug       ----       
5'   aggucggg  ga   gcaguau    uguaua 
     ||||||||  ||   |||||||    ||||| u
3'   uccggccc  cu   cguuaua    acguag 
   aa        ug  -ca       auca       
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_416: 86062-86123 [-]
intergenic
Database links

Mature sequence pte-miR-92a-5p

Accession MIMAT0046233
Sequence

1 - 

aggucggggugauuggcaguauu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-92a-3p

Accession MIMAT0046234
Sequence

41 - 

uauugcacucgucccggccuaa

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).