Stem-loop sequence pte-mir-96

AccessionMI0038104 (change log)
DescriptionParasteatoda tepidariorum miR-96 stem-loop
Literature search

1 open access papers mention pte-mir-96
(1 sentences)

Stem-loop
   -               -        u ucu 
5'  uuuggcacugucaca uuuuugug g   a
    ||||||||||||||| |||||||| |    
3'  gaacugugauagugu aaaaacau u   u
   c               u        c uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_537.1: 22595291-22595350 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-96
pte-mir-263aScf5bK3_537.1: 22595157-22595215 [+]
pte-mir-96Scf5bK3_537.1: 22595291-22595350 [+]
Database links

Mature sequence pte-miR-96-5p

Accession MIMAT0046239
Sequence

1 - 

uuuggcacugucacauuuuugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-96-3p

Accession MIMAT0046240
Sequence

39 - 

aaaaauugugauagugucaagc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).