Stem-loop sequence pte-mir-981

AccessionMI0038105 (change log)
DescriptionParasteatoda tepidariorum miR-981 stem-loop
Literature search

1 open access papers mention pte-mir-981
(1 sentences)

Stem-loop
   --    a    -       c     c   a 
5'   cggg uuca cgacgac gagca ucu a
     |||| |||| ||||||| ||||| ||| a
3'   gucc aagu gcuguug cuugu aga a
   aa    a    u       -     -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_303: 3350430-3350487 [-]
intergenic
Database links

Mature sequence pte-miR-981-5p

Accession MIMAT0046241
Sequence

1 - 

cgggauucacgacgaccgagc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-981-3p

Accession MIMAT0046242
Sequence

37 - 

uucguugucguugaaaccugaa

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).