Stem-loop sequence pte-mir-993a

AccessionMI0038106 (change log)
DescriptionParasteatoda tepidariorum miR-993a stem-loop
Stem-loop
   -g ga        au      a   -ug  u 
5'   g  ccuguaga  cgggcu cug   ug u
     |  ||||||||  |||||| |||   || u
3'   c  ggacaucu  gcucga gac   ac a
   ug aa        cu      a   uua  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_142: 3107379-3107441 [+]
intergenic
Database links

Mature sequence pte-miR-993a-5p

Accession MIMAT0046243
Sequence

1 - 

gggaccuguagaaucgggcuacu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-993a-3p

Accession MIMAT0046244
Sequence

41 - 

gaagcucgucucuacaggaacgu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).