Stem-loop sequence pte-mir-993b-1

AccessionMI0038107 (change log)
DescriptionParasteatoda tepidariorum miR-993b-1 stem-loop
Stem-loop
   -cuac        uc          uagac     
5'      ccuguaga  cgggcuuuug     ugcu 
        ||||||||  ||||||||||     ||| u
3'      ggacaucu  gcucgaagac     acga 
   ucuau        cu          ---uu     
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_833: 3580170-3580234 [-]
intergenic
Database links

Mature sequence pte-miR-993b-5p

Accession MIMAT0046245
Sequence

1 - 

cuacccuguagauccgggcuuuug

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-993b-3p

Accession MIMAT0046246
Sequence

43 - 

gaagcucgucucuacagguaucu

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).