Stem-loop sequence pte-mir-993b-2

AccessionMI0038108 (change log)
DescriptionParasteatoda tepidariorum miR-993b-2 stem-loop
Literature search

2 open access papers mention pte-mir-993b-2
(2 sentences)

Stem-loop
   -cuac         c          uaguu   g 
5'      ccuguagau cgggcuuuug     ugu a
        ||||||||| ||||||||||     ||| a
3'      ggacauuua gcucgaagac     acg u
   ucuau         u          ---uu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_6239: 334437-334503 [+]
intergenic
Database links

Mature sequence pte-miR-993b-5p

Accession MIMAT0046245
Sequence

1 - 

cuacccuguagauccgggcuuuug

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-993b-2-3p

Accession MIMAT0046247
Sequence

45 - 

gaagcucguauuuacagguaucu

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).