Stem-loop sequence pte-mir-11940

AccessionMI0038110 (change log)
DescriptionParasteatoda tepidariorum miR-11940 stem-loop
Stem-loop
   -ucc            -a   c    c 
5'     gucacuguuacu  cug uaac u
       ||||||||||||  ||| |||| a
3'     cggugauaauga  gau auug a
   ugaa            aa   u    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_44: 82126-82180 [+]
intergenic
Database links

Mature sequence pte-miR-11940-5p

Accession MIMAT0046250
Sequence

1 - 

uccgucacuguuacuacugcu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11940-3p

Accession MIMAT0046251
Sequence

35 - 

uagaaaguaauaguggcaagu

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).