Stem-loop sequence pte-mir-11942a

AccessionMI0038112 (change log)
DescriptionParasteatoda tepidariorum miR-11942a stem-loop
   -c u                    uguguu 
5'   g uaagacugucaguguuuggc      a
     | ||||||||||||||||||||      u
3'   c auucugacagucauaaaccg      a
   aa c                    ucuuuu 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_165.1: 1758563-1758624 [-]
Database links

Mature sequence pte-miR-11942a-5p

Accession MIMAT0046254

1 - 


 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11942a-3p

Accession MIMAT0046255

41 - 


 - 62

Get sequence
Evidence experimental; Illumina [1]


PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).