Stem-loop sequence pte-mir-11942b

AccessionMI0038113 (change log)
DescriptionParasteatoda tepidariorum miR-11942b stem-loop
Literature search

1 open access papers mention pte-mir-11942b
(2 sentences)

Stem-loop
   -ugc                   ugaa 
5'     uaagacugucaguguuugg    u
       |||||||||||||||||||    u
3'     guucugacggucacaaacu    u
   ggua                   uuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_265: 1038429-1038484 [+]
intergenic
Database links

Mature sequence pte-miR-11942b-5p

Accession MIMAT0046256
Sequence

1 - 

ugcuaagacugucaguguuugg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11942b-3p

Accession MIMAT0046257
Sequence

36 - 

aaacacuggcagucuugaugg

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).