Stem-loop sequence pte-mir-11942c

AccessionMI0038114 (change log)
DescriptionParasteatoda tepidariorum miR-11942c stem-loop
   --                      uuucu 
5'   uguuaagacugucaguguuugg     a
     ||||||||||||||||||||||     u
3'   acaauucugacggucacaaacu     c
   aa                      cuuaa 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_50: 6968144-6968202 [-]
Clustered miRNAs
< 10kb from pte-mir-11942c
pte-mir-11942cScf5bK3_50: 6968144-6968202 [-]
pte-mir-11942dScf5bK3_50: 6967991-6968049 [-]
Database links

Mature sequence pte-miR-11942c-5p

Accession MIMAT0046258

1 - 


 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11942c-3p

Accession MIMAT0046259

38 - 


 - 59

Get sequence
Evidence experimental; Illumina [1]


PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).