Stem-loop sequence pte-mir-11942d

AccessionMI0038115 (change log)
DescriptionParasteatoda tepidariorum miR-11942d stem-loop
Literature search

1 open access papers mention pte-mir-11942d
(2 sentences)

Stem-loop
   --                       uuua 
5'   uguuaagacugucaguguuuggg    a
     |||||||||||||||||||||||    a
3'   acaguucugacagucacaaacuu    u
   ag                       ugaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_50: 6967991-6968049 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-11942d
pte-mir-11942cScf5bK3_50: 6968144-6968202 [-]
pte-mir-11942dScf5bK3_50: 6967991-6968049 [-]
Database links

Mature sequence pte-miR-11942d-5p

Accession MIMAT0046260
Sequence

1 - 

uguuaagacugucaguguuuggg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11942d-3p

Accession MIMAT0046261
Sequence

38 - 

aaacacugacagucuugacaga

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).