Stem-loop sequence pte-mir-14

AccessionMI0038117 (change log)
DescriptionParasteatoda tepidariorum miR-14 stem-loop
Literature search

1 open access papers mention pte-mir-14
(2 sentences)

Stem-loop
   --  u      - u       u   uucau 
5'   gg agagau c gaaggcu acg     u
     || |||||| | ||||||| |||      
3'   cc ucucua g uuucuga ugc     a
   gc  c      a u       c   uucuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_774.1: 775553-775611 [-]
intergenic
Database links

Mature sequence pte-miR-14-5p

Accession MIMAT0046264
Sequence

1 - 

gguagagaucugaaggcuuac

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-14-3p

Accession MIMAT0046265
Sequence

37 - 

ucagucuuuugaaucucuccccg

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).