Stem-loop sequence pte-mir-11945

AccessionMI0038119 (change log)
DescriptionParasteatoda tepidariorum miR-11945 stem-loop
Stem-loop
   ---          uc      c  c   ucc 
5'    agcaacauau  acugga gg uga   a
      ||||||||||  |||||| || |||    
3'    ucguuguaua  ugaccu cc acu   u
   cgc          ga      a  a   ccu 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_524: 1134778-1134838 [-]
intergenic
Database links

Mature sequence pte-miR-11945-5p

Accession MIMAT0046268
Sequence

1 - 

agcaacauauucacuggacggc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11945-3p

Accession MIMAT0046269
Sequence

39 - 

cauccaguagauauguugcucgc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).