Stem-loop sequence pte-mir-11951a

AccessionMI0038126 (change log)
DescriptionParasteatoda tepidariorum miR-11951a stem-loop
Literature search

1 open access papers mention pte-mir-11951a
(1 sentences)

Stem-loop
   --a       u      u      - uuu 
5'    aagcucu gggaaa uauguu c   a
      ||||||| |||||| |||||| |   u
3'    uucgaga cucuuu guacaa g   u
   cua       c      u      u cgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_537.1: 13300262-13300319 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-11951a
pte-mir-11951bScf5bK3_537.1: 13305839-13305897 [-]
pte-mir-11951aScf5bK3_537.1: 13300262-13300319 [-]
Database links

Mature sequence pte-miR-11951a-5p

Accession MIMAT0046280
Sequence

1 - 

aaagcucuugggaaauuauguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11951a-3p

Accession MIMAT0046281
Sequence

37 - 

cauguuuucuccagagcuuauc

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).