Stem-loop sequence pte-mir-11951b

AccessionMI0038127 (change log)
DescriptionParasteatoda tepidariorum miR-11951b stem-loop
Literature search

1 open access papers mention pte-mir-11951b
(1 sentences)

Stem-loop
   --a            a c      -  aag 
5'    aagcucuuggga a aauguu gu   a
      |||||||||||| | |||||| ||    
3'    uucgggagcucu u uuacaa ca   g
   gua            a u      a  auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_537.1: 13305839-13305897 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-11951b
pte-mir-11951bScf5bK3_537.1: 13305839-13305897 [-]
pte-mir-11951aScf5bK3_537.1: 13300262-13300319 [-]
Database links

Mature sequence pte-miR-11951b-5p

Accession MIMAT0046282
Sequence

1 - 

aaagcucuugggaaacaauguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11951b-3p

Accession MIMAT0046283
Sequence

38 - 

cauuuuaucucgagggcuuaug

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).