Stem-loop sequence pte-mir-11957

AccessionMI0038136 (change log)
DescriptionParasteatoda tepidariorum miR-11957 stem-loop
Stem-loop
   --                      ag   g 
5'   augucucaauggcauagugguu  gac a
     ||||||||||||||||||||||  |||  
3'   uacagaguuaccguaucaccaa  uug g
   uu                      -a   c 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_44: 6393498-6393556 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-11957
pte-mir-11957Scf5bK3_44: 6393498-6393556 [+]
pte-mir-11947b-2Scf5bK3_44: 6393863-6393919 [+]
Database links

Mature sequence pte-miR-11957-5p

Accession MIMAT0046298
Sequence

1 - 

augucucaauggcauagugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11957-3p

Accession MIMAT0046299
Sequence

38 - 

ccacuaugccauugagacauuu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).