Stem-loop sequence pte-mir-11960

AccessionMI0038140 (change log)
DescriptionParasteatoda tepidariorum miR-11960 stem-loop
Literature search

1 open access papers mention pte-mir-11960
(2 sentences)

Stem-loop
   --    u           u     a 
5'   augg aaauuguucac cagau g
     |||| ||||||||||| |||||  
3'   uacc uuuaacaagug gucua c
   cg    c           c     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_112: 1037640-1037689 [-]
intergenic
Database links

Mature sequence pte-miR-11960-5p

Accession MIMAT0046304
Sequence

1 - 

augguaaauuguucacucagau

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11960-3p

Accession MIMAT0046305
Sequence

29 - 

cugcgugaacaauuucccaugc

 - 50

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).