Stem-loop sequence pte-mir-11961b

AccessionMI0038142 (change log)
DescriptionParasteatoda tepidariorum miR-11961b stem-loop
Stem-loop
   --g   ggu               ac  uu 
5'    ggc   uucugcugugaaacg  ga  g
      |||   |||||||||||||||  ||  c
3'    ucg   aagaugacacuuugc  uu  a
   uua   auc               cu  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_2297: 46907-46967 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-11961b
pte-mir-11961aScf5bK3_2297: 44299-44359 [+]
pte-mir-11961cScf5bK3_2297: 45051-45112 [+]
pte-mir-11961bScf5bK3_2297: 46907-46967 [+]
Database links

Mature sequence pte-miR-11961b-5p

Accession MIMAT0046308
Sequence

1 - 

gggcgguuucugcugugaaacg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11961b-3p

Accession MIMAT0046309
Sequence

40 - 

uuucacaguagaacuagcuauu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).