Stem-loop sequence pte-mir-11961c

AccessionMI0038143 (change log)
DescriptionParasteatoda tepidariorum miR-11961c stem-loop
Stem-loop
   ---g     u           ----          
5'     gucgg uucugcuguga    gacggcggu 
       ||||| |||||||||||    |||||||| c
3'     caguu aagacgacacu    cugcugucg 
   uuua     u           augc          
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_2297: 45051-45112 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-11961c
pte-mir-11961aScf5bK3_2297: 44299-44359 [+]
pte-mir-11961cScf5bK3_2297: 45051-45112 [+]
pte-mir-11961bScf5bK3_2297: 46907-46967 [+]
Database links

Mature sequence pte-miR-11961c-5p

Accession MIMAT0046310
Sequence

1 - 

ggucgguuucugcugugagacg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11961c-3p

Accession MIMAT0046311
Sequence

40 - 

uaucacagcagaauuugacauuu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).