Stem-loop sequence pte-mir-11962a

AccessionMI0038144 (change log)
DescriptionParasteatoda tepidariorum miR-11962a stem-loop
Stem-loop
   --                     a  aauu 
5'   cauauuucagaaauggcauca gu    u
     ||||||||||||||||||||| ||     
3'   guaugaaguuuuuacuguagu ca    u
   ac                     -  acac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_265: 10546954-10547012 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-11962a
pte-mir-11962aScf5bK3_265: 10546954-10547012 [+]
pte-mir-11962bScf5bK3_265: 10550016-10550074 [+]
Database links

Mature sequence pte-miR-11962a-5p

Accession MIMAT0046312
Sequence

1 - 

cauauuucagaaauggcaucaa

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11962a-3p

Accession MIMAT0046313
Sequence

38 - 

gaugucauuuuugaaguaugca

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).