Stem-loop sequence pte-mir-11963b-1

AccessionMI0038148 (change log)
DescriptionParasteatoda tepidariorum miR-11963b-1 stem-loop
Stem-loop
   --    g       c        --    gc 
5'   augu uucaugg acaacggu  uagc  g
     |||| ||||||| ||||||||  ||||   
3'   uaca aaguacc uguugcca  guug  u
   uu    a       a        aa    gc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_126: 4356179-4356238 [+]
intergenic
Database links

Mature sequence pte-miR-11963b-5p

Accession MIMAT0046320
Sequence

1 - 

auguguucauggcacaacgguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11963b-3p

Accession MIMAT0046321
Sequence

39 - 

ccguuguaccaugaaaacauuu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).