Stem-loop sequence pte-mir-11964

AccessionMI0038150 (change log)
DescriptionParasteatoda tepidariorum miR-11964 stem-loop
Stem-loop
            -u          uu    aau 
5' agauaaaug  auaucugguc  guga   u
   |||||||||  ||||||||||  ||||   a
3' ucuauuuac  uauagaucag  uacu   a
            cu          --    aau 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_169: 3166310-3166369 [-]
intergenic
Database links

Mature sequence pte-miR-11964-5p

Accession MIMAT0046322
Sequence

1 - 

agauaaauguauaucuggucu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11964-3p

Accession MIMAT0046323
Sequence

39 - 

ugacuagauauuccauuuaucu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).