Stem-loop sequence pte-mir-11965-1

AccessionMI0038151 (change log)
DescriptionParasteatoda tepidariorum miR-11965-1 stem-loop
Stem-loop
   --   a         u         g 
5'   gau aaggaauuu uguucauau u
     ||| ||||||||| |||||||||  
3'   cua uuccuuaaa acaaguaua a
   cu   c         c         a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_401: 1572416-1572467 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-11965-1
pte-mir-11965-2Scf5bK3_401: 1568889-1568940 [-]
pte-mir-11965-1Scf5bK3_401: 1572416-1572467 [+]
Database links

Mature sequence pte-miR-11965-5p

Accession MIMAT0046324
Sequence

1 - 

gauaaaggaauuuuuguucaua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-11965-3p

Accession MIMAT0046317
Sequence

31 - 

ugaacacaaauuccuucaucuc

 - 52

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).