Stem-loop sequence xla-mir-106

AccessionMI0038231 (change log)
DescriptionXenopus laevis miR-106 stem-loop
Stem-loop
   --aa          a      g   aac 
5'     aagugcuuau gugcag uag   u
       |||||||||| |||||| |||   u
3'     uucacgaaug cacguc auc   a
   gucc          a      -   cag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr8L: 48822350-48822405 [-]
intergenic
Clustered miRNAs
< 10kb from xla-mir-106
xla-mir-106chr8L: 48822350-48822405 [-]
xla-mir-18a-1chr8L: 48822216-48822294 [-]
xla-mir-20chr8L: 48822066-48822139 [-]
xla-mir-19bchr8L: 48821956-48822028 [-]
xla-mir-92a-2chr8L: 48821825-48821900 [-]
xla-mir-363chr8L: 48821690-48821777 [-]
Database links

Mature sequence xla-miR-106-5p

Accession MIMAT0046418
Sequence

1 - 

aaaagugcuuauagugcagguag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence xla-miR-106-3p

Accession MIMAT0046419
Sequence

35 - 

acugcacaguaagcacuuccug

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26548531 "Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1" Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK Dev Biol. 409:26-38(2016).