Stem-loop sequence bta-mir-191b

AccessionMI0038464 (change log)
DescriptionBos taurus miR-191b stem-loop
Stem-loop
   --g    a     -   c       gaa  -  c 
5'    aacg aaucc aag gcagcug   ug cu u
      |||| ||||| ||| |||||||   || ||  
3'    uugc uuagg uuu cgucgac   ac ga g
   ccg    c     g   u       --a  a  g 
Get sequence
Deep sequencing
180 reads, 0 reads per million, 61 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 51727536-51727599 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-191b
bta-mir-425chr22: 51728006-51728092 [+]
bta-mir-191bchr22: 51727536-51727599 [-]
bta-mir-191chr22: 51727524-51727614 [+]
Database links

Mature sequence bta-miR-191b

Accession MIMAT0046738
Sequence

1 - 

gaacgaaauccaagcgcagcug

 - 22

Get sequence
Deep sequencing180 reads, 61 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).