Stem-loop sequence bta-mir-12051

AccessionMI0038480 (change log)
DescriptionBos taurus miR-12051 stem-loop
Literature search

1 open access papers mention bta-mir-12051
(2 sentences)

Stem-loop
   --           acg     g  aag 
5'   ggagcagaugc   gcggg ag   a
     |||||||||||   ||||| ||    
3'   ccuugucuacg   cgucc uc   a
   ag           --a     -  aag 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr24: 31961493-31961543 [+]
intergenic
Database links

Mature sequence bta-miR-12051

Accession MIMAT0046754
Sequence

30 - 

acuccugcagcaucuguuccga

 - 51

Get sequence
Deep sequencing9 reads, 8 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).