![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3085 |
|||||
Accession | MI0039500 (change log) | ||||
Description | Homo sapiens miR-3085 stem-loop | ||||
Literature search |
2 open access papers mention hsa-mir-3085 | ||||
Stem-loop |
c -u a u ucu ag g uu u 5' cc acucuggga gg gccau g ggccag agu gau a || ||||||||| || ||||| | |||||| ||| ||| u 3' gg ugggacccu cc cggua c ucgguc uca cug g - uc c c --u -g - -- u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3085-5p |
|
Accession | MIMAT0048635 |
Sequence |
14 - aggugccauucugagggccaggagu - 38 |
Deep sequencing | 45 reads, 16 experiments |
Evidence | not experimental |
Mature sequence hsa-miR-3085-3p |
|
Accession | MIMAT0048636 |
Sequence |
54 - ucuggcugcuauggcccccuc - 74 |
Deep sequencing | 67 reads, 21 experiments |
Evidence | not experimental |
References |
|
1 |
PMID:26473382
"A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome"
Annu Rev Genet. 49:213-242(2015).
|