![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-6529 |
|||||
Accession | MI0039501 (change log) | ||||
Description | Homo sapiens miR-6529 stem-loop | ||||
Literature search |
3 open access papers mention hsa-mir-6529 | ||||
Stem-loop |
a - uu - a c a gcg gu 5' acc ug cucuuga gag u agaggcgcag gu uca g ||| || ||||||| ||| | |||||||||| || ||| u 3' ugg au gagaauu cuu a uuuccguguc cg agu c - c gc u c u - --a aa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-6529-5p |
|
Accession | MIMAT0048637 |
Sequence |
14 - gagagaucagaggcgcagagug - 35 |
Deep sequencing | 18 reads, 11 experiments |
Evidence | not experimental |
Mature sequence hsa-miR-6529-3p |
|
Accession | MIMAT0048638 |
Sequence |
53 - ccugugccuuuuacuucuuuaa - 74 |
Deep sequencing | 2 reads, 2 experiments |
Evidence | not experimental |
References |
|
1 |
PMID:26473382
"A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome"
Annu Rev Genet. 49:213-242(2015).
|