Stem-loop sequence dre-mir-181a-3

AccessionMI0039512 (change log)
DescriptionDanio rerio miR-181a-3 stem-loop
Literature search

18 open access papers mention dre-mir-181a-3
(68 sentences)

Stem-loop
   g    ucu   a a           ug      a    gcaa 
5'  cgag   cag g acauucaacgc  ucggug guuu    g
    ||||   ||| | |||||||||||  |||||| ||||    u
3'  gcuc   guc c ugugaguugug  agcuac caaa    g
   a    ucc   c a           --      -    aaga 
Get sequence
Deep sequencing
919294 reads, 5.89e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr3: 34197447-34197530 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-181a-3
dre-mir-181a-3chr3: 34197447-34197530 [+]
dre-mir-181cchr3: 34197694-34197771 [+]
Database links

Mature sequence dre-miR-181a-5p

Accession MIMAT0001623
Previous IDsdre-miR-181a
Sequence

14 - 

aacauucaacgcugucggugagu

 - 36

Get sequence
Deep sequencing4592586 reads, 11 experiments
Evidence by similarity; MI0001380

Mature sequence dre-miR-181a-3-3p

Accession MIMAT0048654
Sequence

52 - 

accaucgaguguugaguguacc

 - 73

Get sequence
Deep sequencing831 reads, 11 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).