Stem-loop sequence dre-mir-181b-3

AccessionMI0039514 (change log)
DescriptionDanio rerio miR-181b-3 stem-loop
Literature search

12 open access papers mention dre-mir-181b-3
(42 sentences)

Stem-loop
   aaa  u    aucaa         cug          gga  g 
5'    gg caca     cauucauug   ucgguggguu   uu u
      || ||||     |||||||||   ||||||||||   ||  
3'    cc gugu     guaaguaac   agucacucga   aa a
   gac  u    -caac         --a          aag  a 
Get sequence
Deep sequencing
99133 reads, 5.76e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr22: 22825793-22825877 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-181b-3
dre-mir-181a-1chr22: 22826004-22826087 [-]
dre-mir-181b-3chr22: 22825793-22825877 [-]
Database links

Mature sequence dre-miR-181b-5p

Accession MIMAT0001270
Previous IDsdre-miR-181b
Sequence

14 - 

aacauucauugcugucgguggg

 - 35

Get sequence
Deep sequencing297640 reads, 11 experiments
Evidence experimental; cloned [1-2]

Mature sequence dre-miR-181b-3-3p

Accession MIMAT0048656
Sequence

54 - 

cucacugaacaaugaaugcaa

 - 74

Get sequence
Deep sequencing202 reads, 9 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).