Stem-loop sequence dre-mir-181d

AccessionMI0039515 (change log)
DescriptionDanio rerio miR-181d stem-loop
Stem-loop
   ua g      auaua         au    u      --   c 
5'   c gcugca     cauucauug  gucg uggguu  uca a
     | ||||||     |||||||||  |||| ||||||  |||  
3'   g ugacgu     gugaguaac  cagu acucag  agu u
   ag a      caaac         --    c      cg   g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr21: 8221660-8221743 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-181d
dre-mir-181a-4chr21: 8221805-8221888 [-]
dre-mir-181dchr21: 8221660-8221743 [-]
Database links

Mature sequence dre-miR-181d-5p

Accession MIMAT0048657
Sequence

14 - 

uacauucauugaugucguuggguu

 - 37

Get sequence
Evidence not experimental

Mature sequence dre-miR-181d-3p

Accession MIMAT0048658
Sequence

52 - 

cucacugaccaaugagugcaaa

 - 73

Get sequence
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).