Stem-loop sequence dre-mir-23b-2

AccessionMI0039517 (change log)
DescriptionDanio rerio miR-23b-2 stem-loop
Literature search

5 open access papers mention dre-mir-23b-2
(7 sentences)

Stem-loop
   cugc    ---       --          -  c      gugacu 
5'     uggc   ugugugg  guuccuggcg ug ugauuu      u
       ||||   |||||||  |||||||||| || ||||||       
3'     accg   acacacc  uagggaccgu ac acuaaa      a
   ---c    cca       au          u  -      aauaga 
Get sequence
Deep sequencing
31816 reads, 3.74e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr8: 30167625-30167708 [-]
intergenic
KZ115267.1: 352535-352618 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-23b-2
dre-mir-23b-2chr8: 30167625-30167708 [-]
dre-mir-27bchr8: 30167435-30167525 [-]
dre-mir-24-3chr8: 30162492-30162633 [-]
Database links

Mature sequence dre-miR-23b-5p

Accession MIMAT0048660
Sequence

14 - 

ggguuccuggcgugcugauuu

 - 34

Get sequence
Deep sequencing111 reads, 9 experiments
Evidence not experimental

Mature sequence dre-miR-23b-3p

Accession MIMAT0048661
Sequence

51 - 

aucacauugccagggauuaccac

 - 73

Get sequence
Deep sequencing31705 reads, 11 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).