Stem-loop sequence dre-mir-7133

AccessionMI0039519 (change log)
DescriptionDanio rerio miR-7133 stem-loop
Literature search

1 open access papers mention dre-mir-7133
(1 sentences)

Stem-loop
   u     - cu     g        u           uuccua 
5'  ggaga c  gcucu guguugug guuaaacugua      a
    ||||| |  ||||| |||||||| |||||||||||      a
3'  ucucu g  ugaga cacgacac uaguuugauau      c
   -     c uu     a        u           cuacaa 
Get sequence
Deep sequencing
146 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr8: 10020259-10020343 [+]
intergenic
Database links

Mature sequence dre-miR-7133-5p

Accession MIMAT0048664
Sequence

14 - 

ugguguuguguguuaaacugua

 - 35

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence not experimental

Mature sequence dre-miR-7133-3p

Accession MIMAT0048665
Sequence

53 - 

uaguuugauucacagcacaaga

 - 74

Get sequence
Deep sequencing142 reads, 9 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).