Stem-loop sequence dre-mir-7133

AccessionMI0039519 (change log)
DescriptionDanio rerio miR-7133 stem-loop
Stem-loop
   u     - cu     g        u           uuccua 
5'  ggaga c  gcucu guguugug guuaaacugua      a
    ||||| |  ||||| |||||||| |||||||||||      a
3'  ucucu g  ugaga cacgacac uaguuugauau      c
   -     c uu     a        u           cuacaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr8: 10020259-10020343 [+]
intergenic
Database links

Mature sequence dre-miR-7133-5p

Accession MIMAT0048664
Sequence

14 - 

ugguguuguguguuaaacugua

 - 35

Get sequence
Evidence not experimental

Mature sequence dre-miR-7133-3p

Accession MIMAT0048665
Sequence

53 - 

uaguuugauucacagcacaaga

 - 74

Get sequence
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).