Stem-loop sequence dre-mir-128-3

AccessionMI0039520 (change log)
DescriptionDanio rerio miR-128-3 stem-loop
Literature search

5 open access papers mention dre-mir-128-3
(9 sentences)

Stem-loop
            aaugc       ugg      cu    cgcu 
5' gagcggcug     ggggccg   cgcugu  gaga    c
   |||||||||     |||||||   ||||||  ||||    u
3' cucgccgac     cucuggc   gugaca  cucu    a
            cuuuu       caa      --    uauc 
Get sequence
Deep sequencing
5797 reads, 245 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
KN150366.1: 5626-5706 [-]
intergenic
Database links

Mature sequence dre-miR-128-3-5p

Accession MIMAT0048666
Sequence

14 - 

cggggccguggcgcugucugaga

 - 36

Get sequence
Deep sequencing146 reads, 10 experiments
Evidence not experimental

Mature sequence dre-miR-128-3p

Accession MIMAT0001824
Previous IDsdre-miR-128
Sequence

50 - 

ucacagugaaccggucucuuuu

 - 71

Get sequence
Deep sequencing16969 reads, 11 experiments
Evidence experimental; cloned [1]

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).