Stem-loop sequence dre-mir-29b3

AccessionMI0039521 (change log)
DescriptionDanio rerio miR-29b3 stem-loop
Literature search

8 open access papers mention dre-mir-29b3
(80 sentences)

Stem-loop
   --a                  uu    gug uga 
5'    gcugguuucaaguggugu  uaga   c   u
      ||||||||||||||||||  ||||   |   c
3'    ugacuaaaguuuaccacg  aucu   g   a
   uug                  --    -aa uaa 
Get sequence
Deep sequencing
1170 reads, 63.6 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 32440125-32440190 [-]
intergenic
Database links

Mature sequence dre-miR-29b3-5p

Accession MIMAT0048667
Sequence

2 - 

gcugguuucaagugguguuuuaga

 - 25

Get sequence
Deep sequencing70 reads, 8 experiments
Evidence not experimental

Mature sequence dre-miR-29b3-3p

Accession MIMAT0048668
Sequence

44 - 

uagcaccauuugaaaucaguguu

 - 66

Get sequence
Deep sequencing1062 reads, 11 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).