Stem-loop sequence dre-mir-7132

AccessionMI0039522 (change log)
DescriptionDanio rerio miR-7132 stem-loop
Stem-loop
      ug  u     g     g              u  gau 
5' guu  gg cccuu acuug ucuaagcuccucag gu   g
   |||  || ||||| ||||| |||||||||||||| ||   a
3' caa  uc gggaa ugaac agauuugaggaguc ca   u
      cu  u     a     g              -  aau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr3: 59063759-59063840 [+]
intergenic
Database links

Mature sequence dre-miR-7132-5p

Accession MIMAT0048669
Sequence

14 - 

gacuuggucuaagcuccucagu

 - 35

Get sequence
Evidence not experimental

Mature sequence dre-miR-7132-3p

Accession MIMAT0048670
Sequence

50 - 

ugaggaguuuagagcaaguaaa

 - 71

Get sequence
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).