![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gga-mir-9-4 |
|||||
Accession | MI0039523 (change log) | ||||
Description | Gallus gallus miR-9-4 stem-loop | ||||
Literature search |
![]()
19 open access papers mention gga-mir-9-4 | ||||
Stem-loop |
- guug uc g ug g 5' ggguug uua uuugguuaucuagcu uaugag gu u |||||| ||| ||||||||||||||| |||||| || 3' cccaau aau aagccaauagaucga auacuu ua c c -aaa ga a cu g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gga-miR-9-5p |
|
Accession | MIMAT0001195 |
Previous IDs | gga-miR-9 |
Sequence |
14 - ucuuugguuaucuagcuguauga - 36 |
Deep sequencing | 23818269 reads, 5 experiments |
Evidence | by similarity; MI0000466 |
Mature sequence gga-miR-9-4-3p |
|
Accession | MIMAT0048671 |
Sequence |
53 - auaaagcuagauaaccgaaagua - 75 |
Deep sequencing | 299364 reads, 5 experiments |
Evidence | not experimental |
References |
|
1 |
PMID:26473382
"A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome"
Annu Rev Genet. 49:213-242(2015).
|